Written and maintained by CASRAI Editorial Board
Last updated
Short answer: 27F and 1492R are a pair of broad-range bacterial primers that bind near the two ends of the 16S rRNA gene, so they amplify nearly the whole gene (a major product of about 1,400 bp in one published Sanger SOP) rather than a short hypervariable window. They are called universal, but they are not unbiased: the exact 27F sequence you use changes which bacteria you see.
This page is general reference for researchers and lab staff choosing or reading a full-length 16S workflow. It reports sequences and results from the sources cited below; it is not a validated protocol for your samples.
Definition and scope
The 16S rRNA gene is the standard marker for identifying bacteria and profiling bacterial communities. 27F (forward) and 1492R (reverse) anneal near its 5′ and 3′ ends. Because they bracket almost the entire gene, the amplicon spans all of the variable regions (V1 to V9) in one product. Sequencing it gives more taxonomic information per read than a single region such as V3-V4, which is why the pair is used for isolate identification by Sanger sequencing and for full-length community profiling on long-read platforms. Variants of the names you may see for the same pair include 27F/1492R, 27f and 1492r primers, and the “1492R primer” on its own.
Primer sequences and degeneracy
Two published forms of 27F matter in practice. 1492R is the same in both comparisons below.
| Primer | Sequence (5′ to 3′) | Notes from the source |
|---|---|---|
| 27F-I (conventional) | AGAGTTTGATCMTGGCTCAG (M = A or C) | Used in the Oxford Nanopore 16S Barcoding Kit; 3 sequence variants (Waechter et al., 2023) |
| 27F-II (more degenerate) | for example AGRGTTYGATYMTGGCTCAG | Derived from earlier work (Klindworth 2013; Matsuo 2021); the full set is 16 forward and 2 reverse variants (Waechter et al., 2023) |
| 1492R | CGGTTACCTTGTTACGACTT | Reverse primer paired with 27F in both studies and in the CHMI Sanger SOP |
How the pair is used in practice
Sanger sequencing of an isolate
The CHMI standard operating procedure for identifying unknown bacterial isolates amplifies the gene with 27F and 1492R and expects a major product of approximately 1,400 bp. Its example reaction uses 0.2 µM of each primer, about 150 ng of template (under 250 ng) in 50 µL, with 30 cycles of 95 °C, 55 °C and 72 °C (1 min 40 s extension). That is one laboratory’s SOP, not a universal recipe. The same SOP submits three reads per sample, from 27F, an internal primer (515F, GTGCCAGCMGCCGCGGTAA) and 1492R, so the gene can be assembled “without gaps”. It also notes that using a single gene “affects your specificity and resolution for identifying species” and that “No database is comprehensive”.
Nanopore full-length profiling
Waechter et al. (Frontiers in Genetics, 2023) compared 27F-I and 27F-II, each with 1492R, on human fecal samples sequenced on nanopore. The more degenerate 27F-II gave a different community picture:
| Measure (fecal samples) | 27F-I | 27F-II |
|---|---|---|
| Shannon diversity | 3.733 | 4.271 (p < 0.001) |
| Firmicutes | 80.4% | 49.4% |
| Bacteroidota | 4.8% | 33.2% |
| Bacteroides (genus) | 2.189% | 17.853% |
| Bifidobacterium (genus) | 0.000% | 3.427% |
| Correlation with American Gut data | r = 0.130 | r = 0.864 |
The authors concluded that 27F-II should be preferred for nanopore analysis of fecal samples, and cautioned that the comparison “can only be indicative” because sampling, extraction and platform differences also vary between datasets.
Limitations
- Primer degeneracy changes results. The Bifidobacterium row above shows a genus that was not detected at all with the conventional 27F-I. Degenerate primers widen coverage but, per Waechter et al., can raise the risk of non-specific amplification and primer dimers.
- Long reads trade accuracy for length. The same paper notes that full-length reads come at the expense of lower sequencing accuracy: about 6% error on early nanopore chemistry, “well below 2%” with Q20+ chemistry and R10.4 flow cells.
- Resolution depends on the kit and the database. The conventional 27F-I nanopore kit is described as validated only for genus-level resolution, and one gene cannot resolve every species.
- Database contamination. Frank et al. (Applied and Environmental Microbiology, 2008) re-examined 27f and 1492r, reported that primer-binding sequences contaminate the termini of many public rRNA sequences, and proposed a revised 27f that better preserved a Lactobacillus to Gardnerella ratio in vaginal samples under stringent amplification.
27F/1492R compared with a short-read region such as V3-V4
The sources above support a short decision checklist. It is a reading of those papers, not a rule from any standard.
- You need to identify a single cultured isolate with Sanger sequencing: the 27F/1492R amplicon, read from both ends plus an internal primer, is the approach described in the CHMI SOP.
- You want more of the gene per read in a community study and can accept lower per-read accuracy: full-length amplification is the option the nanopore literature describes, but the 27F choice affects the community you see.
- You need to compare against an existing short-region dataset or reference collection: check how that dataset’s primers were chosen before comparing taxa, since the American Gut correlation above differed by 27F form.
- You are outsourcing the work: the region and primers are part of the service specification. See the next-generation sequencing service buying guide.
Common misunderstandings
- “Universal” does not mean unbiased. It means broad-range. The two 27F forms above produced very different Firmicutes and Bacteroidota proportions from fecal samples.
- The amplicon is not the whole story. Identification depends on the reference database used afterward, which the CHMI SOP notes is never comprehensive. See identifying bacteria for the wider context.
- A published cycling program is not transferable as is. The CHMI conditions are one lab’s SOP for isolates; see how to choose primers for PCR and the function of primers in a PCR reaction for the general principles.
- Full-length 16S is not metagenomics. It amplifies one marker gene, whereas metagenomics sequences DNA from the whole community.
Frequently asked questions
What is the 1492R primer?
1492R is the reverse primer of the pair, with the sequence 5′-CGGTTACCTTGTTACGACTT-3′ in the CHMI SOP and in Waechter et al. (2023). It anneals near the 3′ end of the 16S rRNA gene.
What size is the 27F/1492R amplicon?
The CHMI SOP expects a major product of approximately 1,400 bp.
Are 27F and 1492R really universal primers?
They are broad-range, but coverage depends on the exact sequence. In the nanopore fecal comparison, the conventional and degenerate 27F gave different phylum proportions and different detection of Bifidobacterium.
Should I use 27F-I or 27F-II?
For nanopore analysis of human fecal samples, Waechter et al. state that the more degenerate 27F-II should be preferred. The sources read do not make a general recommendation for other sample types.
Sources
- Waechter C. et al. “Comparative analysis of full-length 16s ribosomal RNA genome sequencing in human fecal samples using primer sets with different degrees of degeneracy.” Frontiers in Genetics 14:1213829 (2023). frontiersin.org. Read 2026-11-08.
- CHMI SOPs. “Identification of unknown bacterial isolates using Sanger sequencing of the 16S rRNA gene.” chmi-sops.github.io. Read 2026-11-08.
- Frank J.A. et al. “Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes.” Applied and Environmental Microbiology 74(8):2461-2470 (2008). doi:10.1128/AEM.02272-07.
