Written and maintained by CASRAI Editorial Board
Last updated
BankIt is the web-based form that the National Center for Biotechnology Information (NCBI) provides for sending nucleotide sequences to GenBank, the public DNA sequence database. Researchers use it to deposit individual sequences with their annotation and to obtain the accession numbers that journals ask authors to cite. This page covers GenBank submission through BankIt for laboratory investigators; for the field itself, see what biology is.
What it is used for in research
Most journals require any DNA or amino acid sequences described in a manuscript to be deposited in a public sequence database as part of publication. GenBank, the European Nucleotide Archive and the DNA Data Bank of Japan exchange data daily as members of the International Nucleotide Sequence Database Collaboration (INSDC), so a sequence needs to be submitted to only one of them. A GenBank submission through BankIt gives authors the accession numbers that identify their data and let readers retrieve the sequences once the article is published.
NCBI describes table2asn as the tool used primarily for annotated genomes and large batches of sequences, and the Sequence Read Archive (SRA) as the place for runs of unassembled reads, for example from 454, Illumina or PacBio instruments. Those data types do not belong in a single-sequence web submission.
Install or access (official source only)
BankIt runs in a web browser, so there is nothing to install. It is reached at https://www.ncbi.nlm.nih.gov/WebSub/, where you log in or register to submit or to view previous submissions. NCBI also offers the unified Submission Portal at https://submit.ncbi.nlm.nih.gov/ for multiple submission types, and an overview of all routes at https://www.ncbi.nlm.nih.gov/genbank/submit/.
Step-by-step task
Exact screen names change as NCBI updates the form, so follow the labels shown in the current BankIt help. The overall sequence of a submission is:
- Prepare the sequence in FASTA format. A FASTA record is a definition line starting with a greater-than sign and an identifier, followed by the nucleotide sequence:
>Sample_01 ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATC - Log in at the BankIt address above with your NCBI account and start a new submission.
- Enter the submitter and contact details that NCBI staff will use for any questions about the record.
- Choose the release option. GenBank will, on request, withhold release of a new submission for a specified period. If the accession number or the sequence appears in print or online before that date, the sequence is released.
- Enter the reference information for the associated manuscript, if any.
- Provide the sequence and its source details by pasting or uploading the FASTA data, and add the feature annotation the form asks for.
- Review the validation results and submit. Resolve any problems the form reports before final submission.
Output and how to read it
The result of a successful GenBank submission is an accession number that uniquely identifies your data. NCBI states that GenBank typically assigns accession numbers within two working days of submission. Include the accession number in the manuscript, preferably in a footnote on the first page of the article, or as the journal requires. Once the record is public it can be viewed in the GenBank flatfile format, which contains fields such as LOCUS, DEFINITION, ACCESSION, VERSION, ORGANISM, REFERENCE, FEATURES and ORIGIN.
Troubleshooting
- Validation messages before submission: read each message in the form and correct the sequence or annotation it points to, then validate again.
- Record cited or published early: if the accession number or sequence appears in print or online before the requested release date, GenBank releases the sequence. NCBI asks authors to send the full publication data (all authors, title, journal, volume, pages and date) to [email protected] as soon as the paper appears.
- Corrections after release: revisions or updates to GenBank entries can be made by the submitters at any time; send them to [email protected] with the accession number in the subject line.
Free alternatives
| Tool or system | Host | Typical use |
|---|---|---|
| NCBI BankIt | NCBI | Web form for submitting nucleotide sequences to GenBank |
| NCBI Submission Portal | NCBI | Unified web system for multiple GenBank submission types |
| table2asn | NCBI | Command-line program that creates sequence records (ASN.1 .sqn files), used primarily for annotated genomes and large batches |
| Sequence Read Archive (SRA) | NCBI | Runs of unassembled reads, for example from Illumina or PacBio |
| CyVerse Data Store | CyVerse | Storage of large biological datasets and analysis workflows |
Related reading: biology compared with biochemistry.
FAQ
What is a GenBank submission, and how does BankIt fit in?
A GenBank submission is the deposit of sequence data, with its annotation, in the public GenBank database. BankIt is one of NCBI’s web-based ways to make that deposit; the Submission Portal is the unified system for multiple submission types.
How long does GenBank take to assign an accession number?
NCBI states that GenBank typically assigns accession numbers within two working days of submission.
Can I keep my sequence confidential until my paper is published?
Yes. Sequences submitted before publication can be kept confidential upon request. GenBank will withhold release for a specified period, but if the accession number or sequence data appears in print or online before that date, the sequence is released.
Do I need to submit to GenBank, ENA and DDBJ separately?
No. Data exchange between DDBJ, ENA and GenBank occurs daily, so you need to submit your sequences to only one of these repositories.
When should I use table2asn or SRA instead?
NCBI describes table2asn as used primarily for annotated genomes and large batches of sequences, and directs runs of unassembled reads to the Sequence Read Archive.
Can I update a record after submission?
Yes. Revisions or updates to GenBank entries can be made by the submitters at any time, by email to [email protected] with the accession number in the subject line.
Sources
All sources below were checked on 2026-11-07.
- NCBI, How to submit data to GenBank: https://www.ncbi.nlm.nih.gov/genbank/submit/
- NCBI, BankIt: https://www.ncbi.nlm.nih.gov/WebSub/
- NCBI, Submission Portal: https://submit.ncbi.nlm.nih.gov/
- NCBI, What is table2asn?: https://www.ncbi.nlm.nih.gov/genbank/table2asn/
