Written and maintained by CASRAI Editorial Board
Last updated
Short answer. An 18S primer is a short oligonucleotide that anneals to the 18S ribosomal RNA (rRNA) of eukaryotes. Two unrelated jobs use the name. In RT-qPCR, an 18S primer pair measures 18S rRNA as a reference (normaliser) gene, the same role a GAPDH primer pair plays. In sequencing, 18S primers amplify a variable region of the 18S rRNA gene to survey which eukaryotes are in a sample. The primers, the cDNA step and the pitfalls differ, so decide which job you have first.
What an 18S primer targets
The 18S rRNA is the RNA component of the small subunit of the eukaryotic ribosome. Kuchipudi and colleagues describe rRNA as “an abundant and one of the most conserved genes in all cells” (Virology Journal 2012, 9:230). That abundance and conservation make it attractive as an internal control. For amplicon surveys the same gene is useful because conserved stretches flank variable regions. The species and region a primer was designed for matter in both uses.
18S primers as a qPCR reference gene (and the GAPDH primer variant)
A reference gene is measured alongside the gene of interest so that differences in input and reverse-transcription efficiency can be corrected. 18S rRNA is widely used for this: Qiagen’s technical FAQ calls it “a widely used control for qRT-PCR analyses” with “invariant expression across tissues, cells, and experimental treatments” (read 2026-11-08). GAPDH and beta-actin are other common choices, and a GAPDH primer pair is used in the same way.
Published evidence shows why the choice must be tested rather than assumed. Kuchipudi et al. compared ACTB, GAPDH, 18S rRNA, ATP5B and ATP5G1 in influenza-infected human, pig, chicken and duck cells. 18S rRNA was the most stable, with GAPDH second, while ACTB and GAPDH expression was “highly affected by infection”. In human bronchial epithelial cells the BestKeeper standard deviation of Cp averaged 0.437 for 18S rRNA against 1.338 for ACTB. That result applies to that infection model; it is not a rule that 18S always beats GAPDH. For the validation workflow, see selecting and validating qPCR reference genes.
Two practical traps
- Reverse transcription priming. rRNA has no poly-A tail, so an oligo-dT primed cDNA reaction does not copy it. Kuchipudi et al. used random primers for cDNA synthesis. If your target mRNA is reverse transcribed with oligo-dT, the 18S control needs a priming method that captures rRNA.
- Abundance. Qiagen notes that the “extremely high expression” of 18S rRNA in most cell types makes it difficult to use as a normaliser when several assays run in the same reaction (multiplexing). Kuchipudi et al. used cDNA diluted 1:25 per reaction.
Published examples exist, but they are species-specific. For chicken and duck, Kuchipudi et al. list 18S forward TGTGCCGCTAGAGGTGAAATT with reverse TGGCAAATGCTTTCGCTTT, and GAPDH forward GAAGCTTACTGGAATGGCTTTCC with reverse CGGCAGGTCAGGTCAACAA. Their human and pig primers were commercial and unpublished. Do not copy a sequence from another species without checking that it matches your organism. For a full explanation of the method see qPCR and RT-qPCR.
18S primers for amplicon sequencing (metabarcoding)
For community surveys, 18S primers amplify a variable region that is then sequenced. The Earth Microbiome Project 18S protocol (read 2026-11-08) targets the V9 region with the 1391f-1510r pair: Euk1391f (GTACACACCGCCCGTC) and EukBr (TGATCCTTCTGCAGGTTCACCTAC). The expected amplicon is about 260 ± 50 bp. The project describes the forward primer as universal and EukBr as favouring eukaryotes; with mismatches the pair can still amplify bacteria and archaea.
- The protocol runs 25 µL reactions: 94 °C for 3 min, 35 cycles of 94 °C for 45 s, 57 °C for 60 s and 72 °C for 90 s, then 72 °C for 10 min, in triplicate per sample with the replicates pooled.
- For host-associated samples with little eukaryotic biomass, an optional mammalian blocking primer (five deoxyinosines and a 3′ C3 spacer) is offered. The protocol states it reduces host sequences but “does not completely eliminate” them, so host reads still need filtering during analysis.
- Low-biomass samples may give faint bands or none, and 5-10% PhiX is added on MiSeq and HiSeq runs.
Comparison: reference gene versus amplicon use
| Question | RT-qPCR reference | 18S amplicon sequencing |
|---|---|---|
| What is measured | 18S rRNA abundance as a normaliser | Variable region of the 18S rRNA gene, here V9 |
| Starting material | cDNA, made with random priming because rRNA lacks poly-A | Template DNA from the sample |
| Published example | Chicken and duck 18S primers (Kuchipudi et al. 2012) | 1391f-1510r, about 260 ± 50 bp (Earth Microbiome Project) |
| Main caution | Very high abundance; stability shown only for the tested system | Not eukaryote-exclusive; host reads are reduced, not eliminated |
Where it matters for labs
- Check species match: a primer sequence published for one organism is a starting point, not a guarantee for another.
- Report what you used. The MIQE reporting checklist covers primer sequences, reference gene validation and normalisation.
- Input RNA quality affects any RT-qPCR normalisation; see RNA Integrity Number for how integrity is scored.
- For amplicon work, record the region, primer pair, cycling conditions and host-read filtering so results can be compared.
Common misunderstandings
- “18S is always the best normaliser.” It was the most stable in one infection study; the same paper acknowledges the criticism that the ribosomal fraction may not represent the cellular mRNA population.
- “An 18S primer set only amplifies eukaryotes.” The EMP protocol states that mismatched primers can amplify bacteria and archaea.
- “Oligo-dT cDNA works for any gene.” Not for rRNA, which lacks a poly-A tail.
FAQ
What is an 18S primer?
A forward or reverse oligonucleotide that anneals to 18S rRNA or its gene, used either for an RT-qPCR reference assay or for amplicon sequencing of eukaryotes.
Are 18S primers and 18S rRNA primers different?
No. The terms 18S primer, 18S primers, 18S rRNA primer and 18S rRNA primers all refer to primers that target the same molecule. What differs is the application and the region targeted.
Is a GAPDH primer a substitute for an 18S primer?
Both are used as reference genes. In the Kuchipudi study GAPDH ranked second behind 18S rRNA but was affected by infection, so stability has to be tested in your own model.
Sources
- Kuchipudi SV et al. Virology Journal 2012, 9:230. pmc.ncbi.nlm.nih.gov/articles/PMC3499178 (doi 10.1186/1743-422X-9-230), read 2026-11-08.
- Qiagen, FAQ on 18S rRNA as a qRT-PCR control. qiagen.com/us/resources/faq/2675, read 2026-11-08.
- Earth Microbiome Project, 18S amplicon protocol. earthmicrobiome.ucsd.edu, read 2026-11-08.
